Regulation of Expression of Cellulosomal Cellulase and ...

Abstract

The regulation of expression of the genes encoding the cellulases and hemicellulases of Clostridium cellulovorans was studied at the mRNA level with cells grown under various culture conditions. A basic pattern of gene expression and of relative expression levels was obtained from cells grown in media containing poly-, di- or monomeric sugars. The cellulase (cbpA and engE) and hemicellulase (xynA) genes were coordinately expressed in medium containing cellobiose or cellulose. Growth in the presence of cellulose, xylan, and pectin gave rise to abundant expression of most genes (cbpA-exgS, engH, hbpA, manA, engM, engE, xynA, and/or pelA) studied. Moderate expression of cbpA, engH, manA, engE, and xynA was observed when cellobiose or fructose was used as the carbon source. Low levels of mRNA from cbpA, manA, engE, and xynA were observed with cells grown in lactose, mannose, and locust bean gum, and very little or no expression of cbpA, engH, manA, engE, and xynA was detected in glucose-, galactose-, maltose-, and sucrose-grown cells. The cbpA-exgS and engE genes were most frequently expressed under all conditions studied, whereas expression of xynA and pelA was more specifically induced at higher levels in xylan- or pectin-containing medium, respectively. Expression of the genes (cbpA, hbpA, manA, engM, and engE) was not observed in the presence of most soluble di- or monosaccharides such as glucose. These results support the hypotheses that there is coordinate expression of some cellulases and hemicellulases, that a catabolite repression type of mechanism regulates cellulase expression in rapidly growing cells, and that the presence of hemicelluloses has an effect on cellulose utilization by the cell.

Please visit our website for more information on this topic.

The major components of plant cell walls are cellulose, hemicellulose, and lignin, with cellulose being the most abundant component, followed by hemicelluloses. Cellulose consists of long polymers of β-1,4-linked glucose units and forms a crystalline structure, whereas the structure of hemicelluloses is more variable. Hemicelluloses include xylan consisting of β-1,4-linked xylose units, glucomannans consisting of β-1,4-linked glucose and mannose units, and arabinans and galactans in which the main chain sugars include arabinose and galactose, respectively. The cellulolytic bacteria produce a set of enzymes (called cellulosomes) which synergistically hydrolyze crystalline cellulose and hemicelluloses to smaller oligosaccharides and finally to monosaccharides (6, 7, 13, 15, 16, 18, 33, 36).

Clostridium cellulovorans, an anaerobic, mesophilic, and spore-forming bacterium, is one of the most efficient cellulolytic organisms (30). The cellulases and hemicellulases [we will abbreviate these two terms together as (hemi-)cellulases] produced by C. cellulovorans have been studied extensively. Several cellulases (family 5 and 9 endoglucanases and a family 48 exoglucanase), a mannanase, a xylanase, and a pectate lyase have been characterized (6, 16, 18, 33). The genes encoding a cluster of cellulosomal subunits, i.e., the gene cbpA encoding a scaffolding protein, the gene exgS encoding exoglucanase (18), the genes engH, engK, and engM encoding endoglucanases, the gene hbpA encoding a hydrophilic domain and a cohesin (31), and the gene manA encoding a mannanase (28), have been cloned and sequenced. The gene engE encoding an endoglucanase (34), the gene xynA encoding a xylanase (16), and the gene pelA encoding a pectate lyase are not linked to the gene cluster (6, 29, 32), although they are cellulosomal enzymes.

Since plant polysaccharides are the most abundant renewable biomass, cellulolytic microorganisms play a very major role in carbon turnover in nature. It is important to understand how bacteria regulate expression of the various hydrolytic enzymes in order to produce optimal enzyme mixtures for the degradation of different plant materials. Expression of the cellulase genes of C. cellulovorans has been studied at the protein level (8, 17, 22). Only a few studies concerning regulation of the (hemi-)cellulases of C. cellulovorans have been carried out (1, 9). Therefore, many fundamental questions still remain to be answered at the transcriptional level, such as whether the expression of the different (hemi-)cellulases is coordinately regulated by a shared mechanism and whether a low level of constitutive expression of (hemi-)cellulases occurs under all conditions. Preliminary evidence indicated that constitutive synthesis of cellulosome components occurred when cells were grown in the presence of glucose (22). Mechanisms of true induction or repression have not been studied in depth. For these reasons, we have addressed some of the questions related to (hemi-)cellulase gene expression in C. cellulovorans in this paper.

MATERIALS AND METHODS

Bacterial strain and growth conditions.

C. cellulovorans ATCC was used as the source of genomic DNA and total RNA. The organism was grown under strictly anaerobic conditions at 37°C in round-bottom flasks containing a previously described medium (28, 30), which included either di- or monomeric sugars (fructose, glucose, mannose and galactose, lactose, maltose, sucrose, and cellobiose; 0.5%, wt/vol) or polymeric sugars (microcrystalline cellulose [Avicel], locust bean gum, xylan, and pectin; 1%, wt/vol). Avicel was purchased from FMC Corporation. Locust bean gum, xylan (birch wood), and pectin (apples) were purchased from Sigma.

Bacterial protein determination.

The determination of cell mass in cultures grown with cellobiose, cellulose, locust bean gum, pectin, and xylan was based on bacterial-protein estimation as described by Bensadoun and Weinstein (3; see also reference 5). A 500-μl aliquot was centrifuged for 10 min at 13,000 × g. The pellets were washed with 500 μl of sodium phosphate buffer (50 mM, pH 7.0) and incubated with 400 μl of sodium deoxycholate (2%) for 20 min. One hundred microliters of trichloroacetic acid (24%) was added to the suspension, which was centrifuged at 13,000 × g for 10 min. The protein concentration was measured by using the BCA Compat-Able protein assay kit (Pierce) with bovine serum albumin as the standard.

Nucleic acid isolation.

Chromosomal DNA of C. cellulovorans was isolated by using a genomic DNA purification kit (Promega) according to the manufacturer's instructions. Total RNA was extracted from C. cellulovorans broth cultures by using an RNeasy kit (QIAGEN) with the additional step of treatment with RNAlater RNA stabilization reagent (Ambion), and RNase-free DNase (Promega) according to the manufacturers' instructions.

Northern blot analysis.

RNA samples (up to 20 μg) were denatured in RNA sample buffer (250 μl of formamide, 83 μl of 37% [wt/vol] formaldehyde, 83 μl of 6× loading dye [Promega], 50 μl of 10× morpholine propanesulfonic acid [MOPS] buffer [20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA {pH 7.0}], and 34 μl of distilled water) at 65°C for 10 min and separated through 1% agarose gels in MOPS buffer with 17% (vol/vol) formaldehyde. DNA probes were synthesized by PCR by using specific oligonucleotides derived from the C. cellulovorans sequence as a template (Table 1). The probes were nonradioactively labeled by random priming by using digoxigenin (DIG) High Prime (Roche). To add the correct amount of probe to a hybridization, serial dilutions (0.05 to 10 pg) of each probe were spotted on a nylon membrane and labeling sensitivity (amount of labeled DNA per spot) was determined. RNA was transferred overnight to a positively charged nylon membrane (Roche) by capillary transfer by using 20× standard saline/citrate (0.3 M NaCl plus 0.03 M sodium citrate, pH 7). Hybridization was carried out for 16 to 20 h at 50°C in DIG Eazy Hyb buffer solution (Roche). Washing of the membrane and detection of specific transcripts on the blots were carried out by using the DIG luminescent detection kit (Roche) and its protocol.

TABLE 1.

PCR primers used for amplification of reverse transcripts and synthesis of gene-specific probes

Goto Yulin HB™ to know more.

Gene Enzyme encoded 5&#; primer 3&#; primer GenBank accession no. (reference[s]) cbpA Cellulose binding protein ATGCAAAAAAAGAAATCGCTG GGTTGATGTTGGGCTTGCTGTTTC M (29) engH Endoglucanase H GGTGAAACAACAGCGACTCCAACA GCCCCAAGAATCCATCCAAGCTAA U (20, 35) hbpA Hydrophobic protein A AGTATTGGCGTAGTAGTTGCAGGC GTGCGTTATCGGTGAAAGCTCCAA AF (32, 35) manA Mannanase A AGATGCTGAATTGAAGGCGGCAGA CTCCACTCCACTTCATACTTGCAC AF (32, 35) engM Endoglucanase M ATGATGGAGTAGAGGGAAGATGGG GCGTTCAGCATAAGGCATCGTT AF (32, 35) engE Endoglucanase E TACTGATGACTGGGCTTGGATGAG GTTGCTTTCGCTGCTGC AF (34) xynA Xylanase TGTTAGCCTCTTCTGC GATTCCAAGTGCCATAGC AF (18) pelA Pectate lyase A TGATGCACCAAAAACAGCGC CAGTAGAAGAGCATCAAGCC AF (33) engF Endoglucanase F TGGTCTACAATGGTTTCCTGGG GCATCATTCGTTACTCCACC U (27) arfA α-

l

-arabinofurasnosidase ATGGAGGATTTTGGGTTGGG TCGGTGACTCTCCATC AY (16) Open in a new tab

RNA slot blot analysis.

Total RNAs were diluted into appropriate concentrations with water, followed by the addition of two times the volume of the RNA sample buffer. After being incubated for 10 min at 65°C to denature the RNA, the samples were applied to a positively charged nylon membrane (Roche) by using a Hybri-slot apparatus (Gibco-BRL) and the membrane was baked for 30 min at 120°C under vacuum. Filters were hybridized with specific probes as described for the Northern blot analyses.

RT-PCR analysis.

Reverse transcriptase (RT) reactions were performed with total RNA by using a commercially available reverse transcription system (Promega) with slight modifications to the recommended protocol. RT reactions were performed in a final volume of 20 μl, which contained 5 mM MgCl2, 1× RT buffer (10 mM Tris-HCl [pH 9. 0], 50 mM KCl, and 0.1% Triton X-100), 1 mM (each) deoxynucleoside triphosphates, 1 U of recombinant RNasin RNase inhibitor, 15 U of avian myeloblastosis virus reverse transcriptase, 0.25 μM oligonucleotide primer, and 10 μg of substrate RNA. The reaction mixtures were incubated at 42°C for 60 min, and reactions were terminated by heating the mixtures at 95°C for 5 min, followed by incubation on ice for 5 min. The cDNA products were then amplified in 25-μl PCR mixtures by using 2.5 μl of the RT reaction mixture as the template.

DISCUSSION

For investigation of the expression pattern of (hemi-)cellulase genes, mRNA was isolated from cells from continuous cultures taken at various time points. The data demonstrate general and specific regulatory patterns in expression of (hemi-)cellulase genes by C. cellulovorans, including features of their relative expression levels under different culture conditions, i.e., various carbon sources and growth phases. For instance, cellulose and cellobiose induced the transcription of most of the (hemi-)cellulase genes (i.e., cbpA-exgS-engH-engK, manA, engE, and xynA) and the time course of each (hemi-)cellulase gene transcription was approximately the same in all cases. This is the first report at the transcriptional level that the (hemi-)cellulase genes in a clostridial (hemi-)cellulolytic system that included cbpA-exgS (9), engEi, and xynA are coordinately expressed when various substrates such as cellobiose and cellulose are used (Fig. 1 and 2). It was also found that the expression of the noncellulosomal cellulase gene, engF, was regulated just as other cellulosomal cellulase genes were regulated (Fig. 1 and 2). However, through visual inspection of Northern blot analysis (Fig. 1 and 2), the time courses of endoglucanase gene expression (engE and engF) were thought to be greatly different from those of the noncellulosomal α-l-arabinofurasnosidase gene arfA. Cellulose and hemicellulose are closely associated in nature, and it appears that C. cellulovorans has a mechanism(s) to ensure efficient utilization of both types of polymers. These results suggest that a common regulatory mechanism may exist at the transcriptional level for (hemi-)cellulase induction by cellulose and cellobiose. A cellulose metabolite such as cellobiose or a derivative of cellobiose may act as an inducer and may bind to a receptor protein in a signal transduction pathway, and this pathway may then lead to cellulase induction.

Significant expression of most of the genes was observed with polysaccharide substrates such as cellulose, pectin, and xylan, followed by moderate levels with other substrates such as cellobiose and fructose. Low levels of (hemi-)cellulase mRNAs derived from cells grown with lactose, mannose, and locust bean gum (mannan) were observed, and little or no expression was detected with cells grown on glucose, galactose, maltose, and sucrose. These results give a general picture of the potential for (hemi-)cellulase expression when cells are grown on different carbon sources. It was thought that cellulase expression would not occur on carbon sources that promoted rapid growth but would be stimulated by polysaccharides that were difficult to degrade (14, 24). It is noteworthy that expression of cbpA-exgS and engE was especially strong under all conditions tested. The relative transcript levels of the different cellulase genes were comparable to the amounts of the specific proteins produced in the culture medium. This finding is in accordance with previous data on optimization of enzyme production, which showed that the highest CbpA, ExgS, and EngE activity levels were present when cells were grown on cellulose (8, 20, 22). In the general model for the induction of cellulase and hemicellulase expression, a sensor enzyme is constitutively expressed which hydrolyzes cellulose and/or hemicellulose into oligosaccharides that enter the bacterium and activate the expression of the (hemi-)cellulase genes (31, 35). The present observations indicate that (hemi-)cellulase genes in C. cellulovorans are expressed constitutively at low levels but are induced to express at higher levels in the presence of certain polysaccharides, such as cellulose. It has been reported that a basal constitutive level of cellulosomal proteins was synthesized when the cells were grown with glucose or cellobiose (4, 22). These cellulases were secreted into the extracellular culture medium at a very low rate over a long period of incubation (2, 6, 22). These results are not contradictory to our present transcriptional analyses, since it is difficult to analyze the extremely low levels of transcripts (e.g., fewer than 10 strands of mRNA per cell) by methods such as Northern blotting or RT-PCR. The constitutive level of (hemi-)cellulase expression is therefore very low. This type of result has also been reported for other glucose catabolite-repressed systems where proteins were detected but their mRNAs could not be detected (12, 21). Our results indicated that certain carbon sources induced high levels of expression of one gene or a set of genes, whereas the effect on expression of other genes was weak or insignificant. This pattern varied depending on the carbon source. Although being a general inducing compound for (hemi-)cellulases, cellulose induced expression of the cellulase genes, such as cbpA and engE, most strongly. This may be an effect caused by cellobiose, other oligosaccharides, or derivatives of cellobiose that are formed in the cell. The expression of hemicellulase genes (manA and xynA) in cellulose-based medium could be induced by cellulose or by certain contaminants in the commercial preparations of cellulose (10). Xylan especially caused expression of the hemicellulase genes, such as xynA and manA, and was the most potent carbon source for induction of the xylanase gene (xynA). On the other hand, although cellulose and xylan did not act as inducers for the pectate lyase A gene, pectin definitely induced pelA gene expression. Thus, these results indicated that certain polymeric substrates were capable of activating specific genes.

The induction and repression of cellulases by mixed substrates of cellulosic and hemicellulosic sugars reported here is interesting. In the degradation of lignocellulosic substrates by microorganisms, it has been established that the first growth phase is developed at the expense of hemicelluloses and that the cellulase system is developed in a second stage (11, 19). It is feasible that the products of certain hemicellulose degradation, especially locust bean gum, could act as repressors of the cellulolytic system at high concentrations and that as their concentrations drop to low levels, the cellulolytic system is derepressed. This could explain the rapid pattern of growth on hemicelluloses and the sequence of enzyme production of hemicellulases and cellulases. This fact also supports the idea of an interrelationship between the systems regulating (hemi-)cellulases in this bacterium. The observed repression of cellulases by high glucose and cellobiose concentrations is similar to that found for other cellulolytic bacteria (23, 26). However, hemicellulose repression of the cellulolytic activity of cellulose cultures has not been reported previously. This might indicate a hierarchical relationship between the systems regulating cellulases and hemicellulases which would be particularly important in the degradation of complex lignocellulosic materials in nature.

Certain di- or monosaccharides (i.e., fructose, lactose, and cellobiose) induced expression of (hemi-)cellulase genes in C. cellulovorans. The cellulolytic bacteria like C. thermocellum were reported to produce cellulases when grown with soluble carbon sources such as fructose, glucose, and cellobiose (25). Nevertheless, the usual pattern observed with C. cellulovorans was the lack of expression of (hemi-)cellulases in the presence of the easily metabolizable mono- or disaccharides such as glucose, and a catabolite repression-type mechanism seems to exist which mediates control of expression of various genes encoding different extracellular hydrolases as well as the scaffolding protein.

Acknowledgments

We are grateful to Helen Chan for skillful technical assistance and for preparation of the media.

This research was supported in part by the Research Institute of Innovative Technology for the Earth (RITE), Japanese Ministry of Economy, Trade, and Industry (METI), and by grant DE-DDF03-92ER from the U.S. Department of Energy.

If you want to learn more, please visit our website Hemicellulase Enzymes.